1, SSR
SSR (ServerSecurity Reinforcement) is the wave has a “smart server security reinforcement system” with independent intellectual property products used in a variety of advanced public and technical unpublished. SSR is to build a kernel module technology three national security of the operating system product solutions, in real time to a common server operating system upgrades from the system, with safety technology features three levels, from various existing immunity against the fundamental operating system attacks, such as: viruses, worms, hacker attacks.
SSR represents the wave of professional technical concept, the wave of working on credible solutions for server space to help companies / server applications to solve various government safe question.
the wave of SSR server security reinforcement system is based on advanced ROST theory of operating system technology to reinforce security solutions from the bottom of the system. The main principle is through mandatory access to files, directories, processes, registry and services, control, effective control and dispersed the original system administrator privileges, a comprehensive file integrity checking and services, and anti-buffer overflow and other functions, can turn ordinary operating system upgrades from the system so that it meets the national security protection of three server operating system security standards. This product is completely independent development, with specialized security products for system level security protection of intellectual property rights.
This product is completely different from the role of firewall, IDS and other security products at the network layer, is the role of the operating system security reinforcement system in the server layer network core to protect the security of important data and system applications, the fundamental immune to the current attacks against a variety of operating systems, completely prevents the destruction of viruses, worms, hacker attacks and other operating systems and databases, the wave of information security and because of this independence, the server operating system security solutions to fill this blank products, known as “server security expert.”
wave SSR of modules, each module functions and features:
file integrity protection mechanism:
allows the setting of file / directory access rules for the process or user .
registry tamper-proof protection mechanisms:
allows for the process to set the registry key access rules.
the process of mandatory access protection mechanisms:
allows for the process of the process to set access rules.
service mandatory access mechanism:
to stop the new services and drive load in the system, has been installed to prevent the startup type of service changes.
format protection mechanism to prevent:
prevent users from accidentally or other illegal users hard drive formatting operation.
file integrity checking mechanisms:
Basic properties and contents of the verification of all files and integrity checking performed by the recording and comparison of the specified directory.
comprehensive service detection mechanisms:
and the integrity checking is performed by the recording system and Comparative properties and contents of the verification of all the basic services.
Network security access protection mechanisms:
allowing the network to mandatory access control.
proactive defense mechanism:
automatic defense buffer overflow attacks.
exclusive user password authentication mechanism:
using the USB-KEY hardware or identity PKI / CA mechanism Certified Security Administrator
one step ahead of the software self-protection [123 ]
Note: the above information is offered by wave Division Jinan security support portion 2, SIn the solid state relay SR
Solid State Relay (SSR) is a whole new non-contact switching means is composed of electronic components, high reliability, long life and fast, low-noise switching speed , anti-interference ability, resistance to vibration, impact, moisture, moisture, corrosion, can be compatible with the logic circuit advantage TTL, CMOS and the like, gradually accepted by an increasing number of applications. In the field of power control of reactive power compensation, maintenance requirements for the operation of the apparatus, a conventional AC contactor control capacitive load by a huge challenge. Although Universal AC SSR with its unique zero turn features favored by the majority of users, but for the impact of high-voltage high capacitive load current, universal AC SSR difficult to meet the control requirements, which restricts the SSR application in this field .
SSR can be divided into AC and DC, the thyristor is triggered (unidirectional or bidirectional thyristor) by the lower voltage (DC3V ~ 32V), so that the load terminal is turned on, the output current or higher AC, controlled so as to achieve higher voltage or a lower voltage by a strong current. Compared with ordinary AC contactor, a phenomenon which does not produce sparks when turned on and off.
3, SSR
the genome of an organism, in particular the genome of higher organism contains a large number of repeats in a simple repetitive sequence in accordance with the distribution form repetitive sequences in the genome can be divided tandem repeat (tandem repeats sequence, TRS) and interspersed repetitive sequences (dispersed repeats sequence, DRS). Wherein the tandem repeat is connected by a first repeating units associated clusters arrayed. Tandem repeats found in currently two main types: one is composed by the functional genes (e.g., histone genes and rRNA); the other is a non-functional sequence thereof. The length of the repeating unit repeats, tandem repeats can be divided into satellite DNA, microsatellite DNA, minisatellite DNA and the like. micro-Satellite DNA called simple sequence repeat (Simple Sequence Repeat, SSR), refers to a DNA genome by a basic unit is repeated 1-6 times nucleotides configuration, widely distributed in different locations in the genome, the general length in the 200 bp or less. Studies have shown that the content of microsatellites in the genome of eukaryotes is very rich, and often randomly distributed in the nuclear DNA. In the study of the plants by Arabidopsis thaliana, maize, rice, wheat and the like indicate microsatellite is also very rich in plants, evenly distributed throughout the genome of the plant, but the frequency variations occur in different plants microsatellites is very large, as main crops two most common dinucleotide repeat unit (AC) n and (GA) n in rice, wheat, maize, tobacco number frequency distribution is different. Estimated in 3000 there wheat (AC) n sequence was repeated about 6000 (GA) n repeat sequence, the average distance between the two were repeated 704 kb, 440 kb, whereas in rice, (AC) n repeat sequence around about 1000, (GA) n repeat is about 2000, the average distance between repeats are 450 kb, 225 kb. Also found in plants and some of trinucleotide repeats four nucleotides, which is the most common (AAG) n, (AAT) n. In monocots and dicots are also differences in the amount and distribution of SSR, on average were 64.6 kb and 21.2 kb in a SSR. The study also found that a single nucleotide type and dinucleotide repeat SSR mainly located in non-coding region, and some type of trinucleotide coding region. Also in the chloroplast genome, it is also reported some microsatellites, in A / T based sequence repeats. The study found that there is a high variation in the number of microsatellite repeat units, these variants showed polymorphic microsatellite euploid number of repeat unit or a variation in the sequence may not be exactly the same sequence, resulting in a plurality of sites. If these variations can be revealed, you can find different SSR polymorphism in different species and even among different individuals, based on the idea that people develop SSR markers. SSR marker sequence tag also known as microsatellite loci (sequence tagged microsatellite site), abbreviated as STMS, it is the most commonly used of microsatellite markersOne. Since the genomic sequence flanking a particular microsatellite sequences are usually conservative single strong, thus flanking the microsatellite DNA fragments can be cloned, sequenced, and subjected to PCR primers can be synthesized according to the flanking sequence of microsatellite amplification, so that the individual was amplified microsatellite loci. Since mutation of a single repeat unit of microsatellite loci in a number of variations in the individual amplification product length polymorphism generates length, this polymorphism will be called simple sequence repeat length polymorphism (Simple Sequence length polymorphism, SSLP), each amplified loci on this site represents a pair of alleles. Due to the large number of repeat SSR changes, so SSR markers were polymorphic than RFLP it can be much higher, and this is the principle of SSR markers. Compared with other markers, SSR marker has the following advantages: abundance ①, covering the entire genome, revealed a high polymorphism; ② multiple alleles has a characteristic, high information provided; ③ inherited in Mendelian fashion, codominant; ④ each site is determined by the design of the primer sequence, to facilitate the exchange of different laboratories to develop primers. Which is currently the technology has been widely used to construct genetic map, the calibration target gene research, fingerprinting drawing and the like. But it should be seen, SSR markers established first microsatellite flanking sequences of basic research cloning, sequencing, artificially designed and synthesized primers and the positioning mark, mapping, etc., and thus its development cost is very high, each laboratory must cooperate in order to develop more marked. Since the SSR markers have great value, and species-specific strong current in some of the major crops SSR markers have carried out cooperation and common development STMS primer.
Simple Sequence Repeats (Simple Sequence Repeat, SSR)
Simple sequence repeat (SSR), also known as microsatellite DNA, which core sequence tandemly repeated 1 is a 6 bp, which is the most common dinucleotide repeat, i.e., core sequence identical structure (CA) n and (TG) n of each microsatellite DNA, the number of repeating units 60 10 a, which is mainly derived from the number of highly polymorphic different series. The basic principle of SSR markers: The microsatellite sequence ends complementary sequence primers were designed to amplify by PCR microsatellite fragments,Due to the different number of repeats of the core sequence tandem, it is possible to amplify by PCR the PCR products of different lengths, the amplification products were gel electrophoresis, fragments were separated according to the size determined genotype and allele frequencies calculated. In eukaryotes, there are many 2-5bp simple sequence repeats, called “microsatellite DNA” whose sequence is highly conserved ends can be designed double primers for PCR amplification, revealing polymorphisms.
SSR has the following advantages: (l) is generally detected by a single multi-allelic loci; ⑵ microsatellite codominant genetic, it can identify heterozygous and homozygous; ⑶ amount of the desired DNA less. Obviously, when using technical analysis SSR microsatellite DNA polymorphisms have to know the information sequence repeated at both ends of the DNA sequence. If you can not you must first be sequenced directly from the DNA database search. Category
The SSR Depending on the arrangement of the SSR core sequence can be divided into three types:
complete type (perfect). It refers to the core sequence in a repeated manner uninterrupted DNA connected end to end configuration. Such as: ATATATATATATATATATATATATATATATATAT
with incomplete (imperfect). Means between the core of SSR has the following three non-repetitive base, but ends of the core sequence is repeated continuously repeating number is larger than 3. Such as: ATATATATGGATATATATATCGATATATATATATATATGGATATATATAT
complex (compound). It refers to two or more than two tandem core sequence separated by three bases or non-repetitive consecutive three or more, but the continuity of the core sequence repetition number is not less than 5. Such as: ATATATATATATATGGGATATATATATATA type is more complete type SSR markers application
in the three types.
SSR distributed in the plant genome SSR widely distributed in a variety of eukaryote genomes, there is about a 10 ~ 50kb every SSR. SSR number of mammals is about plants5 to 6 times. In plants, there is an average of a 23.3kb SSR; SSR dicot number greater than monocots, the average spacing between the former two SSR is 21.2kb, which is 64.6kb; SSR number of nuclear DNA DNA in the cytoplasm of the SSR, the vast majority of single base repeats and type 2 repeats the nucleotide present in the SSR, non-coding regions, trimeric repeats multi-coding region. Using the value
Microsatellites Since the number of different core sequence repeat, SSR allelic site may exhibit polymorphism (SSLP, simple sequence length polymorphism). Most of the performance of co-dominant inheritance, and some showed dominant inheritance. Since SSR DNA flanking sequences (20bp leaving above) show conserved features, it is possible to design the upstream and downstream PCR primers to amplify the DNA sequence comprising the SSR.
commonly used for microsatellite analysis: genetic mapping; germplasm identification; Genetic Diversity; marker-assisted selection (MAS, marker- assistant seletion, marker- aided seletion); gene targeting; quantitative trait loci (QTLs) Analysis ; pedigree analysis; identification of the parental relationship. Source
the SSR primers Other reference sequences of related species.
by screening libraries, sequencing developing its own SSR primers.
by a nucleic acid database query, the search from the existing SSR sequence comprises a sequence designed primers.
Main technical links the SSR analysis experiments to extract DNA; PCR amplification; electrophoresis and color; electrophoresis band type blanket photographic, recording; data analysis and processing.
wherein, PCR products electrophoretic separation methods are: a high concentration agarose gel electrophoresis (gel only distinguish 4-6bp 4 percentage difference); denaturing polyacrylamide sequence gel electrophoresis; non-denaturing polyacrylamide gel electrophoresis.
Because of the short amplified fragment (generally less than 300bp), the small difference between the gene (typically a few bp), it is usually used to distinguishHigh polyacrylamide gel electrophoresis. On the program, although the denaturing gel than non-denaturing some trouble, but taking into account artifacts occur on non-denaturing gel – heteroduplex molecules, such as lead strip 3-4 SSR heterozygotes occur, instead of the normal 2 band, interfering alleles statistics, we recommend the SSR analysis are used in denaturing gel electrophoresis.
PCR amplification product with a chromogenic method: radioactive isotope autoradiography; fluorescent labeling; ethidium bromide (EB) colorimetric method; silver staining (present method has been applied).
4, SSR
SSR (System Services Representive)
Job description system services representatives:
The System Services Representive (SSR) is primarily responsible for the post sale maintenance . of IBM hardware and software in customer account The SSR performs services activities including stsems assurance, installation planning, account management, system problem determination, discontinuances, relocation, diagnosis etc.
Job Requirement:
⒈ Teamwork, account management, situation handling
⒉ Communication Skill
⒊ Good at Writing and Oral English
⒋ AⅨ, Unix or Linux related Experiences is a good plus
⒌ Bachelor’s Degree or above
5, SSR in Mathematical Statistics
SSR (New after multiple range)
the LSR (Least significant Range Test)
analysis of variance, require several groups of treatment there was a significant difference multiple comparisons fixed models, commonly used methods are the least significant difference in the number method ( LSD) and a least significant range test (LSR). Wherein the number of least significant difference method applied only to a scale LSDα a (a-1) / 2 data for multiple comparisons, the first type will increase the chance of errors committed; Least Significant Range first data ordering method according to positional difference different comparison criteria.
LSR method to calculate the test statistic q method has proposed in 1955 Duncan’s new multiple range test (SSR method) and Tukey proposed in 1949:
SSR = (. Xi.-xj) / SE ~ SSR (p, fe)
q = (xi.-xj.) / SE ~ q (p, fe)
SE = (MSe / r) square root